Omic DNA clone RP23-36G24, and inserted into pBluskript II
  • Omic DNA clone RP23-36G24, and inserted into pBluskript II SK (+) Vector. The human TGFBI cDNA with R124H (CGC to CAC) mutaion was generated by PCR site-directed mutagenesis making use of a primer containing corresponding mutation. In detail, A part of Human TGFBI cDNA fragment from internal BamHI web site to TAG followed by the initial 17bp half of loxP sequence (a) was produced by PCR utilizing mutation containing forward primer #1 and reverse primer #1 shown in beneath. The internet site corresponding towards the R124H mutation is represented in italics with underline. The double underline in primer sequences in what follows represents LY2801653 (dihydrochloride) restriction enzyme internet sites plus the single underline represent anterior or posterior part of loxP sequence. The site corresponding for TAG in reverse primer #1 are represented in italics. Forward Primer #1: 5'-AAAAGGATCC ACCACCACTCAGCTGTACACGGACCACACG GAGAAGCTGAGGCCTGAGATGGAG -3' Reverse Primer #1: 5'- ATGCTATACGAAGTTAT CTA ATGCTTCATCCTCTCTAATA AC -3' A quick double strand DNA fragment for the last 17bp half of loxP sequence followed by SmaI and SalI restriction enzyme internet sites (b) was developed by annealing of two oligonucleotides,PLOS 1 | DOI:ten.1371/journal.pone.0133397 July 21,two /TGFBI Transgenic Mouse Model of Granular Corneal Dystrophy Typeforward primer #2 and reverse primer #2 shown in below. These DNA fragments (a and b) had been ligated and inserted into pBluescript II SK+ (pBSIISK+) working with BamHI and Sal I web site (c). Forward Primer #2: 5'- ACATTATACGAAGTTAT CCCGGG G -3' Reverse Primer #2: 3'- TGTAATATGCTTCAATA GGGCCC CAGCT -5' The DNA fragment for the anterior part of Human TGFBI cDNA from ATG for the internal Bam HI site following NotI site and Kozak sequence (d), which was made by PCR utilizing forward primer #3 and reverse primer #3 shown in beneath and cloned into pCR-BluntII-TOPO (Life Technologies Corp., carlsbad, CA) vector, was inserted into (c) making use of NotI and BamHI web site (e). The kozak sequence and ATG in fowerd primer #3 are represented in lowercase and italics, respectively. Forward Primer #3: 5'- AAAA GCGGCCGC gccacc ATGGCGCTCTTCGTGCGGCTGCT GGCTC -3' Reverse Primer #3: 5'- AAAA GGATCC AACGACTCCCAGGGTCTCGTAAAGG -3' To make brief arm (3Kbp) portion followed by loxP sequence, one more double stranded DNA fragment for the final 17bp of loxP sequence followed by PspOMI restriction enzyme web-site (f), which was created by annealing of two oligonucleotides of forward primer #4 and reverse primer #4 shown in under, was ligated with the DNA fragment (g) produced by PCR applying forward primer #5 and reverse primer #5 shown in below. The resulting DNA fragment was cloned into pBSIISK+ making use of SacII and PspOMI web-site (h). Forward Primer #4: 5'- ACATTATACGAAGTTAT AG -3' Reverse Primer #4: 3'- TGTAATATGCTTCAATA TCCCGG -5' Forward Primer #5: 5'- AAAA CCGCGG CCGCACGTCACACCTGGAGTGGCAAG -3' Reverse Primer #5: 5'- ATGCTATACGAAGTTAT GGAGCTGGAGCACGCGCGGACCC AC -3' The SacII-PspOMI fragment corresponding short arm with LoxP sequence in the construct (h) was inserted into SacII-NotI digested construct (e) and the resulting construct (i) is kozak-cDNA (R124H) flanked with loxP sequence following the brief arm in pBSII SK+ vector. Subsequently, to create construct (j), a PspOMI-NotI fragment corresponding SV40 polyA signal sequence followed by a Neo cassette flanked with FRT sequences from pBS-pA-FNF vector (UNITECH Co., Ltd., Japan) was treated for blunting and inserted into SmaI site, just behind of the rear loxP sequence, with the sonstruct (i).

Howdy, Stranger!

It looks like you're new here. If you want to get involved, click one of these buttons!