Howdy, Stranger!

It looks like you're new here. If you want to get involved, click one of these buttons!

The Up-To-Date Principles Over Paclitaxel

49) objective and Cascade II:512 CCD camera (Photometrics). Image stacks were processed in ImageJ software. Kymographs were generated in Metamorph and used to determine the frequency and directionality of movement of transport vesicles that moved at the rate of >0.1?��m/sec. The antibodies and methods used for staining human and mouse brain tissue are described under Supplemental Experimental Procedures (Zhao et?al., 2007?and?Gong et?al., 2011). Chemically synthesized Fluconazole stealth siRNAs from Invitrogen were used to knock down endogenous EHD1 and EHD3 expression in primary mouse neuronal cultures. A pool of four different siRNAs was transfected into DIV5 neurons at a final concentration of 100?nM using Lipofectamine RNAiMAX (Invitrogen). The siRNA sequences used were as follows: Sense sequences: EHD1-oligo1, CCGCCCUCAGGAAGCUCAAUGACCU; Conditioned medium was collected and assayed for A�� essentially as described (Bali et?al., 2012). An electrochemiluminescene assay was used to measure A��38, A��40, and A��42 in a mouse specific 96-well MULTI-ARRAY multiplex kit (Meso Scale Discovery). Total RNA from mouse primary neurons was isolated using TRIzol (Invitrogen) and cDNA was prepared using the iScript cDNA synthesis kit (BIO-RAD) according to the manufacturer��s recommended protocol. Real-time PCR was performed using iTaq Universal SYBR Green Supermix (BIO-RAD). Relative EHD1 and EHD3 gene expression levels were calculated with the ����Ct method using GAPDH for normalization. Selleckchem BGJ398 Each experiment was performed using at least three independent sets of cultures. Data are presented as mean �� SEM. Statistical significance was determined by t tests (comparison of two groups; Figures 2C, 6B, and S1C) or ANOVA (comparison of three or more groups) using GraphPad Prism software and indicated the figures: ?p?< 0.05; ??p?< 0.01; ???p?< 0.001; ????p?< 0.0001; ns, nonsignificant. We thank Drs. Sangram, S. Sisodia, Kamal Sharma, Marie-Claude Potier, and Vladimir I. Gelfand for helpful discussions. This work was supported by grants from the National Institutes of Health (AG019070 and AG021495 to G.T.; AG022560 and AG030142 to R.V.; CA105489, CA99163, CA87986, and CA116552 to H.B.; and NS055223 Paclitaxel price to A.T.P.), Cure Alzheimer��s Fund (G.T. and R.V.), BrightFocus Foundation (G.T.), and Alzheimer��s Association (G.T.). L.R. was supported by the Swiss National Science Foundation, the Velux Foundation, Bangerter Stiftung, Baugarten Stiftung, and the Novartis Foundation. L.R. and V.U. were supported by the European Neuroscience Campus of the Erasmus Mundus Program. V.B.-P. was partially supported by a fellowship from Alzheimer��s Disease Research Fund of Illinois Department of Public Health. C.G.F. and M.L. were supported by National Institute of General Medical Sciences training grant GM07839-30.
Sign In or Register to comment.